Review



consensus oligonucleotides for the ets (pu.1) sc-2549  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology consensus oligonucleotides for the ets (pu.1) sc-2549
    Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/consensus oligonucleotides for the ets (pu.1) sc-2549/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars, 2026-04
    90/100 stars

    Images



    Similar Products

    consensus tree  (ATCC)
    91
    ATCC consensus tree
    Consensus Tree, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/consensus tree/product/ATCC
    Average 91 stars, based on 1 article reviews
    consensus tree - by Bioz Stars, 2026-04
    91/100 stars
    		  Buy from Supplier
    enterobacterial repetitive intergenic consensus i  (ATCC)
    95
    ATCC enterobacterial repetitive intergenic consensus i
    Enterobacterial Repetitive Intergenic Consensus I, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enterobacterial repetitive intergenic consensus i/product/ATCC
    Average 95 stars, based on 1 article reviews
    enterobacterial repetitive intergenic consensus i - by Bioz Stars, 2026-04
    95/100 stars
    		  Buy from Supplier
    g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp  (ATCC)
    94
    ATCC g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp
    G A C C 23s Rrna Consensus Rbs β Galactosidase Log2 Fold Change B Diminuta Atcc 11568 Bdim Rs13760 C Sp, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp/product/ATCC
    Average 94 stars, based on 1 article reviews
    g a c c 23s rrna consensus rbs β galactosidase log2 fold change b diminuta atcc 11568 bdim rs13760 c sp - by Bioz Stars, 2026-04
    94/100 stars
    		  Buy from Supplier
    29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase  (ATCC)
    98
    ATCC 29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase
    29149 Aayg Locus Consensus Description Gene Size Bp Protein Size Aa Rumgna 02411 Polyprenyl Glycosylphosphotransferase, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase/product/ATCC
    Average 98 stars, based on 1 article reviews
    29149 aayg locus consensus description gene size bp protein size aa rumgna 02411 polyprenyl glycosylphosphotransferase - by Bioz Stars, 2026-04
    98/100 stars
    		  Buy from Supplier
    consensus oligonucleotides for the ets (pu.1) sc-2549  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology consensus oligonucleotides for the ets (pu.1) sc-2549
    Consensus Oligonucleotides For The Ets (Pu.1) Sc 2549, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/consensus oligonucleotides for the ets (pu.1) sc-2549/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    consensus oligonucleotides for the ets (pu.1) sc-2549 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    ets consensus binding core  (Degnan Labs)
    90
    Degnan Labs ets consensus binding core
    Ets Consensus Binding Core, supplied by Degnan Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ets consensus binding core/product/Degnan Labs
    Average 90 stars, based on 1 article reviews
    ets consensus binding core - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology 32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3
    32p Labelled Probes 506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, 506i 5'cggccgcgggaagcggccgcgggaagcagc'3 And Ets 1 Consensus 5'gatctcgagcaggaagttcga'3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    32p- labelled probes-506d 5'cggccgcgggaagcagcctgcgagccgtgc'3, -506i 5'cggccgcgggaagcggccgcgggaagcagc'3 and ets-1 consensus 5'gatctcgagcaggaagttcga'3 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    consensus oligonucleotides  (Santa Cruz Biotechnology)
    95
    Santa Cruz Biotechnology consensus oligonucleotides
    Consensus Oligonucleotides, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/consensus oligonucleotides/product/Santa Cruz Biotechnology
    Average 95 stars, based on 1 article reviews
    consensus oligonucleotides - by Bioz Stars, 2026-04
    95/100 stars
    		  Buy from Supplier
    oligomers containing either a consensus ets or nfκb binding element  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology oligomers containing either a consensus ets or nfκb binding element
    Oligomers Containing Either A Consensus Ets Or Nfκb Binding Element, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligomers containing either a consensus ets or nfκb binding element/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    oligomers containing either a consensus ets or nfκb binding element - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier

    Image Search Results